thelittlehebrewgirl thelittlehebrewgirl
  • 02-11-2018
  • Mathematics
contestada

What are the coordinates of the circumcenter of the triangle?


Please show your work:


Enter your answer below:
( ____ , ____ )

What are the coordinates of the circumcenter of the triangle Please show your work Enter your answer below class=

Respuesta :

gmany
gmany gmany
  • 04-11-2018

It's the right angle. The circumcenter is in half of hypotenuse.

The formula of a midpoint of segment BC:

[tex]M\left(\dfrac{x_B+x_C}{2},\ \dfrac{y_B+y_C}{2}\right)[/tex]

We have the points B(-2, -2) and C(7, -5). Substitute:

[tex]\dfrac{-2+7}{2}=\dfrac{5}{2}=2.5\\\\\dfrac{-2+(-5)}{2}=\dfrac{-7}{2}=-3.5[/tex]

Answer: (2.5, -3.5)

Ver imagen gmany
Answer Link

Otras preguntas

Why is California warm and moderately humid but Nevada is hot and dry? A. The two states are at different latitudes. B. As air moves west over California's mo
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?
What is the diameter of a circle whose circumference measures 86 26/35? Use pi= 22/7
Paulina works out with a 2.5 kilogram mass. What is the mass of the 2.5 kilogram mass in grams?
what are 2 examples of ionic compound?
Mrs.Henderson had 7/12dozen eggs in her refrigerator.Then she used 1/6 dozen eggs to make a cake.What fraction of a dozen is left?
31+34=90-n 45+1=70-k 6×9=41+m
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
the temperature of a sample of matter is a measure of the ?
Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number