chencho21 chencho21

01-10-2020
Mathematics

contestada

The real part of the complex number -5 + 3i is
The imaginary part of the complex number
-5 +31 is

Respuesta :

01-10-2020

Answer:

can you give me options?

Answer Link

Otras preguntas

zach has 8 stores that he manages 6 of those stores are hiring what fraction of his stores are hiring?

Your best friend has been feeling sad for more than two weeks, and you are concerned that he may be experiencing depression. How can you have a positive impact

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

If you tell a friend you don't have any money to lend him when in reality you do, you're demonstrating which of the "reasons for lying"?

If 2/3 + 6 = 7/6p, what is the value of p?

Please help ASAP!!!!!!!!!!!!!

Brainliest to most helpful! Answer asap! The point (−3, 1) is on the terminal side of angle θ, in standard position. What are the values of sine, cosine, and ta

Need help asappp plzz helppp

How was fidel castro able to maintain cuba's independence as a communist state while only being 90 miles off the coast of the united states?

Simplify the expression: (5a^4b^2)^3(-2b^4)