elizebethflores184
elizebethflores184 elizebethflores184
  • 04-02-2022
  • Mathematics
contestada

Want to help me out here?

Want to help me out here class=

Respuesta :

AbbyLovesNat
AbbyLovesNat AbbyLovesNat
  • 04-02-2022

Answer:

i think its the last option.

Step-by-step explanation:

dont know how to explain it

hope this helps

Answer Link
dasiella987
dasiella987 dasiella987
  • 04-02-2022

Answer: My guess would be the second one? I really hope this helps. Sorry I can’t explain how to get it.

Step-by-step explanation:

Answer Link

Otras preguntas

the value x+x(x×) when x = 2
The _______ was Franklin Roosevelt's program designed to fight the Great Depression
Social disparity was one of the major causes of french revolution. Justify the statement
what is x? using the picture below and directions
A penny fell off the top of the building and hit the sidewalk below 3.1 seconds later how many meters did the penny fall to the sidewalk
What is the solution of the system of equations? y = –2x + 8 y = x – 4
If the area of a square is 32 ft2, how long is its diagonal?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
4 (2x-6)=10x-6. solve for x
Towards the end of Anne's diary, her entries stop being about her relationship with Peter and focuses more on what? the burglaries in the house the food