DrakeOVO1 DrakeOVO1
  • 04-06-2017
  • Physics
contestada

Can anybody help me out???!?!?

Can anybody help me out class=

Respuesta :

thejcarnealoqof4z
thejcarnealoqof4z thejcarnealoqof4z
  • 04-06-2017
its the C, the sun and the moon, the other planets are too far away to have any gravitational impacts, the moon impacts the heaviest.
Answer Link
Аноним Аноним
  • 04-06-2017
Only the moon is the correct answer.
Answer Link

Otras preguntas

Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate
Why is California warm and moderately humid but Nevada is hot and dry? A. The two states are at different latitudes. B. As air moves west over California's mo
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
Which body tissue or organ contains the most mitochondria?
(3x^2 + 2x -2) + ( -2x^2 + 5x+5) My answer 5x^2 + 7× +7 Am i right
what is the geometric mean between 6 and 20?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which body tissue or organ contains the most mitochondria?
the perimeter of a square 116ft ?