ejpangel17oyrewh ejpangel17oyrewh
  • 01-11-2017
  • Mathematics
contestada

How many tens and ones in the number 82?

Respuesta :

Аноним Аноним
  • 01-11-2017
8 tens and 2 ones......
Answer Link
micmanmc101 micmanmc101
  • 01-11-2017
The answer is 8 tens, 2 ones. The 8 is in the tens place and the 2 is in the ones place. Look up place value, my friend!
Answer Link

Otras preguntas

How many times does four go into 153 ? What Is the remainder ?
Which of the following is the modern counterpart of the journal and diary? a. A magazine article b. A blog c. A speech d. A newspaper article
solve the simultaneous equation 4x+7y=1 3x+10y=15
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
In the years preceding World War I A)world tensions declined. B)military expenditures decreased. C)imperialistic ambitions seemed to decline. D)there was a s
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10
4x-2y=14 y=1/2x-1 Solve the system of linear equations by substitution. Check your answer.
Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what rule does static electricity follow