helppppey helppppey
  • 02-11-2017
  • Mathematics
contestada

What's 24.67 to one significant figure?

Respuesta :

jdoe0001 jdoe0001
  • 02-11-2017
24.67 is just barely before 25.00, so we should be able to round 20.00, which gives us only one significant digit.
Answer Link

Otras preguntas

I need help with this problem!
What is the interquartile range of the data? 17, 18, 18, 20, 23, 25, 27, 27, 34, 38, 40, 46, 46, 62, 67
Less developed countries (LDCs) have a/an____ population growth. A.average B. negative C. positive D. unchanged
Characteristics of the early u.s. navy "super frigates" included ______________. select all that apply.
need help anybody know how to do this
Find the equation, in point-slope form, of the line that passes -3 and passes through the point (1,2). plz show your work.
In 500 words, explain how the characters of Jem and Scout develop over the course of Part I of To Kill a Mockingbird. Discuss how they change and grow and what
CAN SOMEONNE HELP ME PLEASE !!!
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Who is largely responsible for the spread of hellenistic culture in the 4th century bc?