neslynerazop6hkns neslynerazop6hkns

01-04-2018
Mathematics

contestada

Which is the correct classification and decimal expansion of 7/8?

Respuesta :

Miraculous78 Miraculous78

01-04-2018

What do you mean...... I'm confused

Answer Link

emiliaatkinson emiliaatkinson

01-04-2018

7/8 as a decimal is 0.875
It is a proper fraction as the numerator is less than the denominator

Answer Link

Otras preguntas

An account earns simple interest. Find the annual interest rate, I= $60 P= $500 t= 2 years

if 2^x-4=4a^x-6 what is the value of a

Cell respiration why does a runner breathe hard after finishing a race

What nursing actions best promote communication when obtaining a nursing history? select all that apply?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Two factors that determine whether a reaction will occur spontaneously

The element with the most stable nucleus and smallest mass per particle is

Find the missing value. sin x = .65

Quinn is determining the area of a trapezoid. His work is shown below. mc012-1.jpg Step 1: Break the figure into rectangles and triangles. mc012-2.jpg Step

A line with an underfined slope contains the point (8,3). The point (?, -4) is also on the line. What is the missing x-coordinate?